Preparation

What you need in order to operate the tool.

If you mange to successfully run our toy example you probably noticed we were requested to input 3 files. In the next section we will discuss what those files are :

Design File

could one of 2 options:

1. A design file, in a csv format containing 2 columns : [barcode, variant]

   • barcode - a sequence identifier for the variant. [Needed for matching between a read and a variant].

   • variant - the complete variant sequence. [Needed for the alignment to analyse missmatches and indel's.

2. IUPAC string

Config File

A config.json file containing different possible configuration. This should be a json file containing the following parameters:

{
    "prefix" : "ACAACGCTTTCTGTGTCGTG",
    "suffix" : "",
    "length" : 0,
    "barcode_start" : 20,
    "barcode_end" : 32
}

• prefix : If supplied will remove all reads not starting with the supplied sequence.

• suffix : If supplied will remove all reads not ending with the supplied sequence.

• length : If supplied and set to a value above 0 will only leave reads with

  length - 5 <= len(read) <= length + 5

• barcode_start : Start position of the barcode.

• barcode_end : End position of the barcode.

Reads File/s

A fastq file containing sequenced reads.